| Basic information from miRBase |
| hairpin accession number: MI0002838 |
| Located between position 69558605 and 69558714 on chromosome 9 strand - |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSPTRT00000038855) |
| mature miRNAs for MI0002838: |
| ptr-miR-204 (MIMAT0002535): TTCCCTTTGTCATCCTATGCCT |
| You can find this miRNA in EMBL: AY866197 (accession: AY866197) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |