| Basic information from miRBase |
| hairpin accession number: MI0008581 |
| Located between position 1843413 and 1843521 on chromosome 15_random strand - |
| Overlapping with sense strand of Q6J9M1_PANTR (intron 5). |
| (Ensemble: ENSPTRT00000067399) |
| mature miRNAs for MI0008581: |
| ptr-miR-211 (MIMAT0008071): TTCCCTTTGTCATCCTTCGCCT |
| You can find this miRNA in ENTREZGENE: MIR211 (accession: 100316452) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |