| Basic information from miRBase |
| hairpin accession number: MI0011273 |
| Located between position 1654 and 1786 on chromosome AZM5_27613 strand - |
| mature miRNAs for MI0011273: |
| zma-miR2118c (MIMAT0011762): TTCCTAATGCCTCCCATTCCTA |
| References |
| [1]Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH, Genome Res. 19:1429-1440(2009)., "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" |