miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008503
Located between position 136128863 and 136128944 on chromosome 2b strand -
mature miRNAs for MI0008503:
         ptr-miR-1299 (MIMAT0008018): TTCTGGAATTCTGTGTGAGGG
You can find this miRNA in ENTREZGENE: MIR1299 (accession: 100316087)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"