| Basic information from miRBase |
| hairpin accession number: MI0008503 |
| Located between position 136128863 and 136128944 on chromosome 2b strand - |
| mature miRNAs for MI0008503: |
| ptr-miR-1299 (MIMAT0008018): TTCTGGAATTCTGTGTGAGGG |
| You can find this miRNA in ENTREZGENE: MIR1299 (accession: 100316087) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |