| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005836 |
| Located between position 19455870 and 19455964 on chromosome X strand + |
| Overlapping with antisense strand of Grip84-RD (3UTR 5). |
| (Ensemble: FBtr0301307) (FlyBase: FlyBase) |
| mature miRNAs for MI0005836: |
| dme-miR-979-5p (MIMAT0020876): ACACTGAATTTGGGGGGAATTCT |
| dme-miR-979-3p (MIMAT0005495): TTCTTCCCGAACTCAGGCTAA |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |