| Basic information from miRBase |
| hairpin accession number: MI0012718 |
| Located between position 12172407 and 12172489 on chromosome 5 strand - |
| Overlapping with sense strand of LOC100062059 (intron 5). |
| (Ensemble: ENSECAT00000008170) |
| mature miRNAs for MI0012718: |
| eca-miR-488 (MIMAT0012965): TTGAAAGGCTATTTCTTGGTC |
| You can find this miRNA in ENTREZGENE: MIR488 (accession: 100314813) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |