| Basic information from miRBase |
| hairpin accession number: MI0008790 |
| Located between position 79529294 and 79529389 on chromosome 5 strand + |
| Overlapping with sense strand of XM_527193.2 (intron 1). |
| (Ensemble: ENSPTRT00000031178) |
| mature miRNAs for MI0008790: |
| ptr-miR-580 (MIMAT0008253): TTGAGAATGATGAATCATTAGG |
| You can find this miRNA in ENTREZGENE: MIR580 (accession: 100316530) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |