miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010664
mature miRNAs for MI0010664:
         bol-miR171a (MIMAT0010170): TTGAGCCGTGCCAATATCACG

References
[1]He XF, Fang YY, Feng L, Guo HS, FEBS Lett. 582:2445-2452(2008)., "Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica"