| Basic information from miRBase |
| hairpin accession number: MI0008553 |
| Located between position 158449969 and 158450054 on chromosome 7 strand - |
| Overlapping with sense strand of XM_520865.2 (intron 16). |
| (Ensemble: ENSPTRT00000036921) |
| mature miRNAs for MI0008553: |
| ptr-miR-153 (MIMAT0008047): TTGCATAGTCACAAAAGTGATC |
| You can find this miRNA in ENTREZGENE: MIR153 (accession: 100316107) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |