Basic information from miRBase |
hairpin accession number: MI0006271 |
Located between position 120151439 and 120151529 on chromosome 12 strand - |
Overlapping with sense strand of CIT-014 (exon 1). |
(Ensemble: OTTHUMT00000401866) |
mature miRNAs for MI0006271: |
hsa-miR-1178 (MIMAT0005823): TTGCTCACTGTTCTTCCCTAG |
You can find this miRNA in HGNC: MIR1178 (accession: 35259) |
References | ||||||||||||||
[1]Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M, Oncogene. 27:2015-2026(2008)., "MicroRNA expression signature of human sarcomas" |
PROMOTER INFORMATION | ||||||||||||||
953 | chr12, 118635822-118640912, - | promoter sequence | UCSC |
more data |
Polymorphism data from Patrocles |