| Basic information from miRBase |
| hairpin accession number: MI0017767 |
| Located between position 3902754 and 3902848 on chromosome 2R strand + |
| mature miRNAs for MI0017767: |
| dme-miR-4981-3p (MIMAT0020214): TTGGCCGGTCGAGCAGCGTCT |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |