| Basic information from miRBase |
| hairpin accession number: MI0008517 |
| Located between position 1091580 and 1091716 on chromosome 15_random strand - |
| mature miRNAs for MI0008517: |
| ptr-miR-1302 (MIMAT0008021): TTGGGACATACTTATGCTAAA |
| You can find this miRNA in ENTREZGENE: MIR1302-2 (accession: 100316538) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |