| Basic information from miRBase |
| hairpin accession number: MI0008518 |
| Located between position 739264 and 739400 on chromosome 19_random strand + |
| mature miRNAs for MI0008518: |
| ptr-miR-1302 (MIMAT0008021): TTGGGACATACTTATGCTAAA |
| You can find this miRNA in ENTREZGENE: MIR1302-3 (accession: 100316089) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |