miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008520
Located between position 1514373 and 1514509 on chromosome Un strand -
mature miRNAs for MI0008520:
         ptr-miR-1302 (MIMAT0008021): TTGGGACATACTTATGCTAAA
You can find this miRNA in ENTREZGENE: MIR1302-5 (accession: 100316318)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"