Basic information from miRBase |
hairpin accession number: MI0008522 |
Located between position 141630267 and 141630337 on chromosome 8 strand - |
mature miRNAs for MI0008522: |
ptr-miR-1302 (MIMAT0008021): TTGGGACATACTTATGCTAAA |
You can find this miRNA in ENTREZGENE: MIR1302-7 (accession: 100316091) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |