| Basic information from miRBase |
| hairpin accession number: MI0008523 |
| Located between position 96558861 and 96558987 on chromosome 9 strand - |
| Overlapping with antisense strand of (intron 29). |
| (Ensemble: ENSPTRT00000043676) |
| mature miRNAs for MI0008523: |
| ptr-miR-1302 (MIMAT0008021): TTGGGACATACTTATGCTAAA |
| You can find this miRNA in ENTREZGENE: MIR1302-8 (accession: 100316441) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |