Basic information from miRBase |
hairpin accession number: MI0011581 |
Located between position 11441455 and 11441530 on chromosome X strand + |
Overlapping with sense strand of CG32666-RA (intron 2). |
(Ensemble: FBtr0073508) (FlyBase: FlyBase) |
mature miRNAs for MI0011581: |
dme-miR-2492-5p (MIMAT0020913): TTGGGATCTCTTTATAAAGCGT |
dme-miR-2492-3p (MIMAT0012199): ATGTTTTGTCGAGAGCTTTCAAA |
References |
[1]Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC, Nat Genet. 42:6-9(2010)., "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" |