| Basic information from miRBase |
| hairpin accession number: MI0011321 |
| Located between position 152314 and 152382 on chromosome 14 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSBTAT00000009455) |
| mature miRNAs for MI0011321: |
| bta-miR-2308 (MIMAT0011820): TTGGGCTTGCAGCAGAGAGTAA |
| You can find this miRNA in ENTREZGENE: MIR2308 (accession: 100313129) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |