Basic information from miRBase |
hairpin accession number: MI0007195 |
Located between position 225568 and 225668 on chromosome reftig_62 strand - |
Overlapping with antisense strand of (intron 13). |
(Ensemble: ENSCSAVT00000002430) |
mature miRNAs for MI0007195: |
csa-miR-133 (MIMAT0006128): TTGGTCCCCTTCAACCAGCTA |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" |
more data |
Data from CoGemiR |