| Basic information from miRBase |
| hairpin accession number: MI0016020 |
| Located between position 28302547 and 28302693 on chromosome 14 strand - |
| mature miRNAs for MI0016020: |
| vvi-miR3627 (MIMAT0018017): TTGTCGCAGGAGAGACGGCACT |
| vvi-miR3627* (MIMAT0018018): TCGCCGCTCTCCTGTGACAAG |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |