miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002873
Located between position 20525098 and 20525207 on chromosome 4 strand +
Overlapping with sense strand of XM_001163294.1 (intron 14).
(Ensemble: ENSPTRT00000047500)
mature miRNAs for MI0002873:
         ptr-miR-218 (MIMAT0002570): TTGTGCTTGATCTAACCATGT
You can find this miRNA in EMBL: AY866232 (accession: AY866232)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"