Basic information from miRBase |
hairpin accession number: MI0002873 |
Located between position 20525098 and 20525207 on chromosome 4 strand + |
Overlapping with sense strand of XM_001163294.1 (intron 14). |
(Ensemble: ENSPTRT00000047500) |
mature miRNAs for MI0002873: |
ptr-miR-218 (MIMAT0002570): TTGTGCTTGATCTAACCATGT |
You can find this miRNA in EMBL: AY866232 (accession: AY866232) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |