| Basic information from miRBase |
| hairpin accession number: MI0002879 |
| Located between position 171009590 and 171009699 on chromosome 5 strand - |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSPTRT00000032371) |
| mature miRNAs for MI0002879: |
| ptr-miR-218 (MIMAT0002570): TTGTGCTTGATCTAACCATGT |
| You can find this miRNA in EMBL: AY866238 (accession: AY866238) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |