miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013730
Located between position 14950530 and 14950660 on chromosome 13 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018763)
mature miRNAs for MI0013730:
         tgu-miR-218 (MIMAT0014522): TTGTGCTTGATCTAACCATGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"