miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006976
mature miRNAs for MI0006976:
         osa-miR444d.3 (MIMAT0005972): TTGTGGCTTTCTTGCAAGTTG
         osa-miR444d.2 (MIMAT0005973): TGCAGTTGCTGCCTCAAGCTT
         osa-miR444d.1 (MIMAT0005974): TTGCTGCCTCAAGCTTGCTGC

References
[1]Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ, Proc Natl Acad Sci U S A. 105:4951-4956(2008)., "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"
[2]Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK, BMC Plant Biol. 8:25(2008)., "Identification of novel and candidate miRNAs in rice by high throughput sequencing"
[3]Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ, Genome Res. 18:571-584(2008)., "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa"