| Basic information from miRBase |
| hairpin accession number: MI0008800 |
| Located between position 127483835 and 127483930 on chromosome 7 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000036392) |
| mature miRNAs for MI0008800: |
| ptr-miR-592 (MIMAT0008263): TTGTGTCAATATGCGATGATGT |
| You can find this miRNA in ENTREZGENE: MIR592 (accession: 100316493) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |