| Basic information from miRBase |
| hairpin accession number: MI0008524 |
| Located between position 156671259 and 156671342 on chromosome 5 strand + |
| mature miRNAs for MI0008524: |
| ptr-miR-1303 (MIMAT0008022): TTTAGAGACGGGGTCTTGCTCT |
| You can find this miRNA in ENTREZGENE: MIR1303 (accession: 100316372) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |