miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009939

Located between position 12873320 and 12873404 on chromosome 18 strand +

Overlapping with sense strand of Ttc39c-001 (intron 6).

(Ensemble: OTTMUST00000069821)

mature miRNAs for MI0009939:

mmu-miR-1948* (MIMAT0017344): ATATGAGTATTCTGCCTAAAT

mmu-miR-1948 (MIMAT0009415): TTTAGGCAGAGCACTCGTACAG

You can find this miRNA in MGI: Mir1948 (accession: 3837020)

References

[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"

[2]Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"