miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011289
Located between position 1322833 and 1322945 on chromosome 2RHet strand -
Overlapping with sense strand of CG40263-RF (intron 2).
(Ensemble: FBtr0301779) (FlyBase: FlyBase)
mature miRNAs for MI0011289:
         dme-miR-2279-5p (MIMAT0011784): TTAAATATCTGTGTGTGAAATT
         dme-miR-2279-3p (MIMAT0011785): TTTCACGCGAAGATATTTATTT

References
[1]Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC, Genome Res. 19:1776-1785(2009)., "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line"
[2]Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC, Nat Genet. 42:6-9(2010)., "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila"