Basic information from miRBase |
hairpin accession number: MI0015575 |
Located between position 6314 and 6388 on chromosome scaffold_1418 strand + |
Overlapping with sense strand of (intron 7). |
(Ensemble: ENSCINT00000028406) |
mature miRNAs for MI0015575: |
cin-miR-4024-5p (MIMAT0016539): TTTGTAGGATGAAAAGGTG |
cin-miR-4024-3p (MIMAT0016540): TTTCATCTTTTGATCCTATG |
You can find this miRNA in ENTREZGENE: mir4024 (accession: 100498909) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |