| PROMOTER INFORMATION | ||||||||||||||
| 1081 | chr17, 19188412-19193480, - | promoter sequence | UCSC |  | | |||||||||
| Basic information from miRBase |
| hairpin accession number: MI0006273 |
| Located between position 19247819 and 19247887 on chromosome 17 strand - |
| Overlapping with sense strand of B9D1-005 (intron 5). |
| (Ensemble: OTTHUMT00000132498) |
| mature miRNAs for MI0006273: |
| hsa-miR-1180 (MIMAT0005825): TTTCCGGCTCGCGTGGGTGTGT |
| You can find this miRNA in HGNC: MIR1180 (accession: 35261) |
| References | ||||||||||||||
| [1]Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M, Oncogene. 27:2015-2026(2008)., "MicroRNA expression signature of human sarcomas" | ||||||||||||||
| [2]Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T, BMC Med Genomics. 2:35(2009)., "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 1081 | chr17, 19188412-19193480, - | promoter sequence | UCSC | | | |||||||||