| Basic information from miRBase |
| hairpin accession number: MI0016086 |
| Located between position 95703699 and 95703760 on chromosome 12 strand + |
| mature miRNAs for MI0016086: |
| hsa-miR-3685 (MIMAT0018113): TTTCCTACCCTACCTGAAGACT |
| You can find this miRNA in ENTREZGENE: MIR3685 (accession: 100500802) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |