| Basic information from miRBase |
| hairpin accession number: MI0017287 |
| Located between position 6602685 and 6602765 on chromosome 8 strand + |
| Overlapping with sense strand of AGPAT5-006 (intron 2). |
| (Ensemble: OTTHUMT00000381879) |
| mature miRNAs for MI0017287: |
| hsa-miR-4659a-5p (MIMAT0019726): CTGCCATGTCTAAGAAGAAAAC |
| hsa-miR-4659a-3p (MIMAT0019727): TTTCTTCTTAGACATGGCAACG |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |