| Basic information from miRBase |
| hairpin accession number: MI0014666 |
| Located between position 13050667 and 13050864 on chromosome 1 strand - |
| mature miRNAs for MI0014666: |
| ath-miR773b* (MIMAT0017735): GGCAATAACTTGAGCAAACA |
| ath-miR773b (MIMAT0017736): TTTGATTCCAGCTTTTGTCTC |
| References |
| [1]Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC, Plant Cell. 22:1074-1089(2010)., "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" |