| Basic information from miRBase |
| hairpin accession number: MI0008558 |
| Located between position 130191050 and 130191158 on chromosome 7 strand - |
| mature miRNAs for MI0008558: |
| ptr-miR-182 (MIMAT0008050): TTTGGCAATGGTAGAACTCACACT |
| You can find this miRNA in ENTREZGENE: MIR182 (accession: 100316109) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |