| Basic information from miRBase |
| hairpin accession number: MI0018029 |
| Located between position 44620363 and 44620440 on chromosome 4 strand - |
| Overlapping with sense strand of Pax5-006 (intron 6). |
| (Ensemble: OTTMUST00000015564) |
| mature miRNAs for MI0018029: |
| mmu-miR-5120 (MIMAT0020628): TTTGGGGCTGTGGTGCCACCAGC |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |