| Basic information from miRBase |
| hairpin accession number: MI0008534 |
| Located between position 53327745 and 53327862 on chromosome 6 strand + |
| mature miRNAs for MI0008534: |
| ptr-miR-133b (MIMAT0008030): TTTGGTCCCCTTCAACCAGCTA |
| You can find this miRNA in ENTREZGENE: MIR133B (accession: 100316097) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |