| Basic information from miRBase |
| hairpin accession number: MI0007621 |
| Located between position 1962569 and 1962670 on chromosome 10 strand - |
| mature miRNAs for MI0007621: |
| mml-miR-133c (MIMAT0006777): TTTGGTCCCCTTCAACCAGCTG |
| You can find this miRNA in ENTREZGENE: MIR133C (accession: 100315579) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |