| Basic information from miRBase |
| hairpin accession number: MI0002532 |
| Located between position 17595455 and 17595542 on chromosome 18 strand - |
| Overlapping with antisense strand of XR_024226.1 (intron 13). |
| (Ensemble: ENSPTRT00000018200) RefSeq_dna: RefSeq) |
| mature miRNAs for MI0002532: |
| ptr-miR-133a (MIMAT0002243): TTTGGTCCCCTTCAACCAGCTG |
| You can find this miRNA in EMBL: AY865870 (accession: AY865870) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |