| Basic information from miRBase |
| hairpin accession number: MI0015744 |
| Located between position 7369 and 7462 on chromosome scaffold_1825 strand + |
| mature miRNAs for MI0015744: |
| cin-miR-4187-5p (MIMAT0016805): TTTGGTGTTGTGCTGTGCAA |
| You can find this miRNA in ENTREZGENE: mir4187 (accession: 100498998) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |