| Basic information from miRBase |
| hairpin accession number: MI0008645 |
| Located between position 224932178 and 224932240 on chromosome 2b strand - |
| mature miRNAs for MI0008645: |
| ptr-miR-375 (MIMAT0008125): TTTGTTCGTTCGGCTCGCGTGA |
| You can find this miRNA in ENTREZGENE: MIR375 (accession: 100316383) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |