miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000801
Located between position 10647207 and 10647279 on chromosome V strand +
mature miRNAs for MI0000801:
         cel-lsy-6 (MIMAT0000749): TTTTGTATGAGACGCATTTCG

References
[1]Johnston RJ, Hobert O, Nature. 426:845-849(2003)., "A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans"
[2]Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB, RNA. 10:1309-1322(2004)., "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification"
[3]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"


more data
Data from CoGemiR