miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000355

Located between position 11650018 and 11650117 on chromosome 3L strand +

Overlapping with antisense strand of CG32085-RA (intron 4).

(Ensemble: FBtr0076133) (FlyBase: FlyBase)

mature miRNAs for MI0000355:

dme-miR-274-5p (MIMAT0000332): TTTTGTGACCGACACTAACGGGTAAT

dme-miR-274-3p (MIMAT0020800): CTCGTTTTTGCGATCACAAATTA

You can find this miRNA in TARGETS:MIRTE: miR-274 (accession: miR-274)

References

[1]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"

[2]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[3]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"

more data

Data from CoGemiR