| Basic information from miRBase |
| hairpin accession number: MI0013505 |
| Located between position 1156326 and 1156396 on chromosome CH477228.1 strand + |
| mature miRNAs for MI0013505: |
| aae-let-7 (MIMAT0014299): TGAGGTAGTTGGTTGTATAGT |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |