| Basic information from miRBase |
| hairpin accession number: MI0013470 |
| Located between position 1648025 and 1648108 on chromosome CH477310.1 strand + |
| mature miRNAs for MI0013470: |
| aae-miR-1175 (MIMAT0014264): AAGTGGAGTAGTGGTCTCATCG |
| aae-miR-1175* (MIMAT0015371): TGAGATTCTACTTCTCCGACTTAA |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
| [2]Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" |