| Basic information from miRBase |
| hairpin accession number: MI0013514 |
| Located between position 889085 and 889162 on chromosome CH477453.1 strand - |
| mature miRNAs for MI0013514: |
| aae-miR-2c (MIMAT0014308): TATCACAGCCAGCTTTGATGAGC |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |