Basic information from miRBase |
hairpin accession number: MI0013501 |
Located between position 1859419 and 1859509 on chromosome CH477201.1 strand - |
mature miRNAs for MI0013501: |
aae-miR-307 (MIMAT0014296): CACAACCTCCTTGAGTGAGCGA |
References |
[1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
[2]Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" |
more data |
Data from CoGemiR |