| Basic information from miRBase |
| hairpin accession number: MI0013524 |
| Located between position 429451 and 429538 on chromosome CH477450.1 strand + |
| mature miRNAs for MI0013524: |
| aae-miR-317 (MIMAT0014224): TGAACACAGCTGGTGGTATCT |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |