| Basic information from miRBase |
| hairpin accession number: MI0013500 |
| Located between position 213262 and 213357 on chromosome CH477970.1 strand + |
| mature miRNAs for MI0013500: |
| aae-miR-79 (MIMAT0014294): GCTTTGGCGCTTTAGCTGTATGA |
| aae-miR-79* (MIMAT0014295): TAAAGCTAGATTACCAAAGCAT |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
| [2]Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" |