| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0013437 |
| Located between position 876043 and 876121 on chromosome CH477596.1 strand + |
| mature miRNAs for MI0013437: |
| aae-miR-8* (MIMAT0014214): CATCTTACCGGGCAGCATTAGA |
| aae-miR-8 (MIMAT0014215): TAATACTGTCAGGTAAAGATGTC |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
| [2]Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" |
| more data |
| Data from CoGemiR |