| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0013528 |
| Located between position 555107 and 555187 on chromosome CH477702.1 strand + |
| mature miRNAs for MI0013528: |
| aae-miR-9a (MIMAT0014323): TCTTTGGTTATCTAGCTGTATGA |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
| more data |
| Data from CoGemiR |